-Advertisement-

DNA Profile Analysis

W. Barry Roth



Type of Entry:

  • Project

Type of Activity:

  • hands-on
  • Inquiry lab
  • Authentic assessment
  • Cooperative learning
  • Community outreach

Target Audience:

  • Genetics
  • Biotechnology
  • Advanced/AP Biology


Project

DNA Profile Analysis

Introduction

Each human somatic cell nucleus contains 6.4 billion base pairs of DNA. Portions of this DNA encode over 100,000 genes while the remainder of the DNA is non-coding. 99.9% of human DNA is identical among all individuals. The remaining 0.1% can differ in several ways between individuals. DNA profile analysis focuses on hyper variable regions of DNA. One such form of variability is called VNTR (variable number of tandem repeats).

One DNA segment (locus), a VNTR denoted D1S80 (Kasai et al. 1991), is analyzed in this activity. D1S80 is located on human chromosome 1. This locus is composed of repeating units of 16 nucleotide long segments of DNA (Figure 1). The number of repeats varies from one individual to the next, and is known to range from 15 to over 41 (Budowle et al. 1995). This variability in the number of repeats is the basis for DNA profile analysis.

Methods

Determining the number of repeats requires three general steps:

  1. Obtain a sample of human DNA.

  2. Make many copies of specific VNTR DNA from the sample.

  3. Observe the amplified VNTR DNA.

Obtaining the DNA Sample

The following is a modified version of the procedure described by Walsh et al. (1991)

  1. Vigorously scrape the inside of the cheek with a toothpick.

  2. Place the toothpick in a clean 1.7 ml microcentrifuge tube and add 1000 microliters of H2O. Vortex the sample for 10 seconds, spin in a microcentrifuge for 45 seconds.

  3. Remove toothpick with sterile forceps. Do not disturb pellet! If pellet is disturbed, spin again.

  4. Remove 970 microliters H2O without disturbing pellet.

  5. Add 200 microliters of 5% (w/v) Chelex¬ to the sample (5 g Chelex¬ to 100 ml H2O).

  6. Vortex the sample for 10 seconds.

  7. Add 2 microliters of Proteinase K to the sample and agitate.

  8. Incubate at 56 degrees C for 5 minutes.

  9. Vortex the sample for 10 seconds.

  10. Incubate in a boiling water bath for 8 minutes.

  11. Vortex the sample for 10 seconds.

  12. Spin in a microcentrifuge at maximum speed for 3 minutes.

There should be two distinct layers visible in the reaction tube at the completion of step 13. The bottom layer contains the 5% Chelex and extraneous cellular matter, while the top layer contains an aqueous solution of DNA. The sample is now ready for PCR amplification or may be stored temporarily at 4 degrees C or frozen at -20 degrees C. To reuse these samples after storage, thaw if necessary and repeat steps 12 and 13.

[graphic missing]

PCR Amplification of the D1S80 VNTR Locus

  1. For each PCR reaction the following components are added to a 0.65 milliliter microcentrifuge tube.

    • 4 microliter 50 mM MgCl2
    • 2 microliter 10 mM dNTP Mix
    • 2 microliter 0.2 mg/ml Primer 1 (sequence: 5' gaaactggcctccaaacactgcccgccg 3')
    • 2 microliter 0.2 mg/ml Primer 2 (sequence: 5' gtcttgttggagatgcacgtgccccttg 3')
    • 60 microliter H2O
    • 20 microliter DNA

  2. Add a drop of mineral oil to the top of the reaction mix.

  3. Dilute Taq polymerase enzyme with PCR Buffer to a final concentration of 2.5 units/10 ml PCR Buffer.

  4. Heat the reaction mix to 80 degrees C for 3 minutes then add the Taq polymerase/ buffer solution to the reaction mix.

  5. The reaction tubes are placed into a thermal cycling machine programmed to run 29 cycles with the following parameters.

    • Denaturation        94 degrees C for 1 minute

    • Annealing           65 degrees C for 1 minute

    • Extension           72 degrees C for 1 minute

  6. Completed reactions may be stored at -20 degrees C indefinitely.

Observing DNA Using Agarose Gel Electrophoresis

Once the PCR reaction is completed, the DNA is ready for analysis using gel electrophoresis. For each sample to be analyzed, penetrate the wax barrier with a sterile micropipet tip, remove 20 microliters of the PCR product and place in a fresh microcentrifuge tube. Combine each sample with 2 microliter of loading buffer (30% glycerol, 0.25% xylene cyanol, 0.25% bromphenol blue in H2O) and place into adjacent wells on a 2% agarose gel in 1x TAE (40 mM Tris acetate, 1 mM EDTA). A size marker should be loaded into a well adjacent to the samples (we used the bacteriophage psi x174 digested by the enzyme HaeIII). Electrophorese the DNA at 60 volts until the bromphenol blue indicator in the loading buffer is 2 cm from the bottom of the gel (approximately 1.5 hours for a 10 cm long, 0.4 cm thick gel).

Remove the gel from the electrophoresis apparatus and place it in a container of dilute ethidium bromide (1 mg/ml). After 10 minutes, the gel is ready for viewing under ultraviolet light. The gel may be photographed for later analysis.

Allele sizes can be estimated by comparing them to the size marker. A more accurate determination of allele size can be made using the AmpliFLP» allelic ladder provided in Perkin Elmer's AmpliFLP» D1S80 kit or may be ordered separately from Perkin Elmer.

Obtaining Reagents and Equipment

  • Micropipets: 20 ml, 200 ml and 1000 ml capacities.

  • Micropipet tips

  • Microcentrifuge tubes, 0.65 ml and 1.7 ml capacities.

  • Microcentrifuge

  • Toothpicks

  • Proteinase K

  • Chelex¬ 100 resin, biotechnology grade (Bio-Rad)

  • Vortex test tube mixer

  • Taq polymerase, patented by Hoffman-LaRoche. Comes with 10x PCR buffer and 50 mM MgCl2. (Life Technologies Inc.)

  • 10 mM dNTP mix (Life Technologies Inc.)

  • PCR primers 1 and 2 for D1S80 locus (see text for primer sequence)

  • Mineral oil

  • Electrophoresis power supply

  • Submarine gel kit, including tank tray and combs.

  • Ultraviolet illuminator

  • Agarose

  • 1x TAE: Tris acetate and EDTA

  • Ethidium bromide

  • Gel loading buffer: glycerol, xylene cyanol and bromphenol blue.

  • DNA size marker: psi x174-HaeIII or AmpliFLP» allelic ladder.

  • Thermal cycler

Perkin Elmer sells a PCR amplification kit under the name AmpliFLP» D1S80 (part no. N808-0054) which contains all reagents, tubes, marker and control DNA required to perform 50 PCR amplifications of the D1S80 locus for $425.

References

AmpliFLP» D1S80 PCR Amplification Kit (part number N808-0054) package insert, Perkin Elmer Corporation, Norwalk, Connecticut.

Budowle, B., Baechtel, F.S., Smerick, J.B., Presley, K.W., Giusti, A.M., Parsons, G., Alevy, M.C. & Chakraborty, R. (1995) D1S80 Population Data In African Americans, Caucasians, Southeastern Hispanics, Southwestern Hispanics and Orientals. Journal of Forensic Science, 40(1) 38-44.

Kasai, K., Nakamura, Y. & White, R. (1991) Amplification of a Variable Number of Tandem Repeats (VNTR) Locus (pMCT118) by Polymerase Chain Reaction (PCR) and Its Application to Forensic Science. Journal of Forensic Sciences, 35(5) 1196-1200.

Walsh, S., Metzger, D. & Higuchi, R. (1991) Chelex¬ 100 as a Medium for Simple Extraction of DNA for PCR-Based Typing from Forensic Material. BioTechniques, 10(4), 506-513.


Fellows Collection Index


1996 AE Collection Index


Activities Exchange Index

-Advertisement-

 
-Advertisement-