-Advertisement-
  About AE   About NHM   Contact Us   Terms of Use   Copyright Info   Privacy Policy   Advertising Policies   Site Map
   
Custom Search of AE Site
spacer spacer
Protein Synthesis Project
by Charles Zaremba

Given the DNA code for the hormone insulin, students will determine the correct amino acid sequence of the molecule. This exercise is divided into three sections. Each section contains either the beginning, the middle, or the end of the molecule. Each group will receive one of the segments. Based on the DNA code, the students will determine which segment they received. Once they have determined their segment, they will group up with the missing two segments and complete the exercise. The groups may consist of individuals or cooperative groups of no more than three students each.

Beginning = TACAAACATTTAGTTGTAAACACACCCTCAGTGGACCAACTCCGC
AACATAAACCAAACACCGCTCGCGCCGAAAAAGATATGGGGGTTTTGG

Middle = TCTTCCCTCGCGCTCCTAAACGTTCAACCGGTTCAACTT
AATCCGCCGCCAGGGCCCCGCCCCTCAGAAGTTGGTGATGCG

End = AATCTCCCATCAGACGTTTTTGCCCCGTAACAACTTGTTACAACA
TGGTCATAAACGTCAGAGATGGTCAATCTCTTAATGACGTTAACT


View Activity Description


Activities-To-Go Index


Activities Exchange Index


 
Custom Search on the AE Site

 

-Advertisement-