Protein Synthesis Project
by Charles Zaremba

DNA Molecule Part: AATCTCCCATCAGACGTTTTTGCCCCGTAACAACTTGTTACAACA
TGGTCATAAACGTCAGAGATGGTCAATCTCTTAATGACGTTAACT

Construct a chart using the following directions:

  1. Decode the above strand of DNA. Write out the resulting m-RNA in the space below.

    m-RNA : ___________________________________________________________

    ___________________________________________________________.

    ___________________________________________________________

  2. Divide the m-RNA into its codons by placing a vertical line between them.

  3. Using the amino acid chart found in your textbook, determine the name of the amino acid that each codon codes for. Write the abbreviation of the amino acids in their proper order, in the space below. ___________________________________________________________

    ___________________________________________________________.

  4. After examining the polypeptide chain just constructed, determine if it is a beginning, a middle, or an end segment of the pro insulin molecule.

    Circle the appropriate term denoting your segment.

  5. Find two (2) other segments among your classmates that will complete the protein. If you have a middle segment you will need to find a beginning and an end segment........etc.

  6. Record the entire list of amino acids in the space below. Start with the beginning segment, followed by the middle, and ending with tail.

    ___________________________________________________________

    ___________________________________________________________

    ___________________________________________________________

    ___________________________________________________________

  7. How many molecules of water are lost in the process of creating this entire protein? ____________.

  8. Name the enzymes needed for the following processes to occur:

    1. t-RNA activation _________________________________________________

    2. m-RNA start-up __________________________________________________

    3. termination of protein synthesis ______________________________________

  9. Explain how the proper amino acid is attached to their correct t-RNA molecule.

    _______________________________________________________________

  10. How many amino acids does this complete protein contain? _____________

  11. This protein is called pro-insulin. In order for it to operate in the body, a segment between #30 and #66 amino acids must be removed. The remaining sections are reconected to form insulin. How many amino acids are there in the protein insulin? ____________.

  12. Write a 50 word essay on the importance of insulin in the human body. Turn in one essay per group. Everything else must be turned in triplicate.

    | Search | Home |