-Advertisement-
  About AE   About NHM   Contact Us   Terms of Use   Copyright Info   Privacy Policy   Advertising Policies   Site Map
   
Custom Search of AE Site
spacer spacer

Dry-Lab Demonstration of Sanger Di-deoxy Sequencing of Cloned DNA

Nancy Contolini
Brookfield High School
45 Longmeadow Hill Road
Brookfield, CT 06804

Introduction: After several attempts to decipher the process of Sanger dideoxy sequencing in a simplified but accurate way to explain it to my students (grades 11-12 in Biotechnology), I developed this activity.

Background: The dideoxy chain termination method was developed in 1977 by Fred Sanger at the MRC Laboratory of Molecular Biology. It is based on two facts about DNA synthesis: 1. When a single stranded DNA template is placed together with the 4 deoxynucleotide triphosphates(dNTP's) and a short primer that hybridizes to the beginning of the DNA template, DNA polymerase will direct the synthesis of a complementary strand (complementary to the DNA strand that is to be sequenced). 2. If di deoxynucleotide triphosphates (di dNTP's) are included, DNA strand elongation will terminate when a didNTP is incorporated. This is because di deoxynucleotides lack a 3' hydroxyl group which is needed to form a bond to an adjacent nucleotide.

In the Sanger method, four reaction tubes are set up:

The A, T, G, C tubes each contain:

  1. The DNA template to be sequenced.
  2. A primer sequence which is complementary to the beginning of the template to be sequenced. (Therefore some information about the sequence has to be known in order to use this protocol)
  3. DNA polymerase. (students should understand DNA replication and the function of DNA polymerase)
  4. All four dNTP's (dATP, dTTP, dGTP, dCTP)
  5. One radioactively labeled dNTP, usually 32P dATP. This is needed to expose X-ray film and results in an autoradiogram of a polyacrylamide gel.
  6. One di-deoxynucleotide triphosphate per tube:
    A reaction tube: di dATP
    T reaction tube: di dTTP
    G reaction tube: di dGTP
    C reaction tube: di dCTP
The ratio of the di deoxynucleotide to the deoxynucleotide in each tube is one to one hundred. So that once for every 100 nucleotides added to the nucleotide in question in the template, a di deoxy form of the nucleotide is added. For example, in tube A, each time a thymine nucleotide is encountered in the sequencing reaction, a deoxyadenosine is added for 99 out of 100 times. One out of 100 times a di deoxyadenosine is added. At that point, the synthesis of the strand will terminate. The reaction in the tube will result in collections of DNA strands of differing lengths which reflect the position of the thymine nucleotide in the template strand in question. When the reactions are complete, formamide is added to denature the DNA template from the newly synthesized strands. Each reaction is loaded into a separate lane of a polyacrylamide gel. The gel is fine enough to resolve DNA fragments that differ by a single nucleotide. After electrophoresis, the gel is exposed to X-ray film and an autoradiogram is made. The bands correspond to the lengths of fragments in each reaction tube. The sequence is read from the bottom of the gel to the top. The DNA strand that was sequenced is complementary to the sequence read on the gel. (Reference: Micklos and Freyer. DNA SCIENCE. Cold Spring Harbor Laboratory Press. 1990.)

Activity:

  • Students are given 4 pages each with the sequence of DNA which is to be determined written at the top of each page.
  • Label each page : "A Reaction", "T Reaction". "G Reaction", "C Reaction"
  • Instruct them to write in the primer (5 nucleotides for the sake of simplicity)
  • Then they are to "synthesize" the complementary strand and terminate with a di deoxynucleotide each time they reach the nucleotide complementary to that reaction tube di dNTP.
  • Next they count the number of nucleotides in each fragment that they "synthesized".

Example:

"A" Reaction
DNA:ATTGCTACGTAAGGCTAGTACATGCCT
di dATGTACGGA*(primer)( 9)
di dATCATGTACGGA(12)
di dATTCCGATCATGTACGGA(18)
di dATGCATTCCGATCATGTACGGA(22)
di dACGATGCATTCCGATCATGTACGGA(25)
di dAACGATGCATTCCGATCATGTACGGA(26)

(Notice that the numbers to the right include the primer. The sizes of the fragments correspond to the location of the nucleotide which is complementary to the adenine nucleotide.)

"T" Reaction
DNA: ATTGCTACGTAAGGCTAGTACATGCCT
di dTACGGA (6)
di dTGTACGGA (8)
di dTCATGTACGGA (11)
di dTCCGATCATGTACGGA (16)
di dTTCCGATCATGTACGGA (17)
di dTGCATTCCGATCATGTACGGA (21)
di dTAACGATGCATTCCGATCATGTACGGA (27)

"C" Reaction
DNA: ATTGCTACGTAAGGCTAGTACATGCCT
di dCATGTACGGA (10)
di dCGATCATGTACGGA (14)
di dCCGATCATGTACGGA (15)
di dCATTCCGATCATGTACGGA (19)
di dCGATGCATTCCGATCATGTACGGA (24)

"G" Reaction
DNA: ATTGCTACGTAAGGCTAGTACATGCCT
di dGTACGGA (7)
di dGATCATGTACGGA (13)
di dGCATTCCGATCATGTACGGA (20)
di dGATGCATTCCGATCATGTACGGA (23)

Note that all the fragment sizes are different because each one corresponds to a different nucleotide location on the DNA to be sequenced. When all the fragment sizes are listed in order, the numbers should be sequential from 6 -- 27 (the size of the DNA)

Now, give each student a piece of paper which represents a polyacrylamide gel. Have them draw in the fragments according to size in 4 lanes corresponding to the 4 reactions:

STD. AT CG
    -----    
  -----      
25 -----      
      -----  
        -----
  -----      
    -----    
20       -----
      -----  
  -----      
    -----    
    -----    
15     -----  
      -----  
        -----
  -----      
    -----    
10   -----    
  -----      
    -----    
        -----

Now each student can give their "gel" to a partner who will read the sequence of nucleotides from the bottom up: i.e. on the above gel the lowest band(the smallest fragment which traveled the farthest) is "T", then the next smallest is "G", then "T", then "A" etc. The sequence that is read is the COMPLEMENT to the DNA that was sequenced. Students can check each others' accuracy.

Students can make up their own sequence, follow the procedure above, and have partners use their "gel" to determine if they sequenced correctly.

I find that this step by step procedure works well because it helps students visualize the quite complex process of Sanger dideoxy sequencing.

WARD's and other suppliers can provide actual autoradiograms for students to read, or you can obtain autoradiograms from biotechnology companies and/or pharmaceutical companies engaged in DNA research.

HAVE FUN SEQUENCING!!

Please e me and let me know if this works for you--or any ways to improve the activity.




Activities-To-Go Index


Activities Exchange Index


 
Custom Search on the AE Site

 

-Advertisement-