-Advertisement-
  About AE   About NHM   Contact Us   Terms of Use   Copyright Info   Privacy Policy   Advertising Policies   Site Map
   
Custom Search of AE Site
spacer spacer

DNA Scavenger Hunt

Kathy Paris

Example:

The DNA code is carried to the ribosome by messenger RNA; the code shown is the DNA code; you are to change the code to the m-RNA codon and then look up each triplet codon to determine the letter the coden equals. The letters will form words, in this case, items to find in a scavenger hunt. The items must be listed in the order the code dictates.

Ribosome

DNA = CCC ATG TTC CGT CTG TCC TTC

mRNA GGG UAC AAG GCA GAC AGG AAG

letter start B E N I C E = BE NICE

RIBOSOME 1

CCCTCCAAAAGGATGTTTGTTAGCCGAAGGAAACCATTC


RIBOSOME 2

CCCAGTTTCAGGGAGTTTAGGTAGCGCAGTGTTTTTCCATTTCGCAGCCGT

CCAGTTTTCCGCCTGCGC


RIBOSOME 3

CCCAGTCTGTCCCCAGACAGGTTCAAACGTCTGTAGAAAGCG


RIBOSOME 4

CCCAGTTTCCGTCGTAGC


RIBOSOME 5

CCCAGTAGGTTTCCATTCCTGCGT


RIBOSOME 6

CCCAAAGCGTCCAAACGT


RIBOSOME 7

CCCAGGGACATGATGTTCAGGATGAAACGTCGA


RIBOSOME 8

CCCAGTCTGTCCCCAGACAGGTTCAGTGCGAAACGTCCA


RIBOSOME 9

CCCTCCAAAAGGCGAATGTTTAAAAGGCGA


RIBOSOME 10

CCCCTAAGGAAACGCCGC


RIBOSOME 11

CCCAGGTTTTCCTTA


RIBOSOME 12

CCCGTCTTCTTCCGA


RIBOSOME 13

CCCTAGAAATTATTCGCGCTGCGCCCACTGCCATTCTAGCGCCTGCGTTTT

AGGCGATTCAGG



The amino acid sequence (order) is represented by the ___________________________ in this activity.

The DNA code and m-RNA codon are represented by the _________ in this activity.

If the order of the items you scavenged is wrong, you won't get the prize because the message (correct list of items in order) doesn't make sense. this is an analogy with what goes on in the cell with DNA's message. Write a paragraph explaining what will happen if the DNA message is wrong.

Bonus Mystery Answer Key      Secret Codes: DNA code m-RNA codons



Activities-To-Go Index


Activities Exchange Index


 
Custom Search on the AE Site

 

-Advertisement-