-Advertisement-
  About AE   About NHM   Contact Us   Terms of Use   Copyright Info   Privacy Policy   Advertising Policies   Site Map
   
Custom Search of AE Site
spacer spacer

The Secret DNA Code

Kathy Paris

Transcribe the DNA code (given) into the m-RNA codon. Then, translate the m-RNA codon into words (instead of proteins). NOTE: DNA never leaves the nucleus; only m-RNA, after copying the DNA code, leaves the nucleus and goes to the ribosome. The DNA is shown here only to make the copying process (transcription) easier.

RIBOSOME 1

DNA=CCCCTATTTCCATTTCGATTCTAGTTTTCCTTTGACCGTCCATTCAGG


RIBOSOME 2

CCCCTATTCCCATTTCGTTTCAGTAAAAGTTTCAGGCCATTTGACTTCGCG


RIBOSOME 3

CCCCTATTTCCATTTTAGAGGCGCAGTAAAAGGCTGCGC


RIBOSOME 4

CCCCTACTGATCTTCTCCTTTCGATTCGTTGACCGTCTAAGGAGC


RIBOSOME 5

CCCAAACGCTTAGAGTTTAGGTTATTCAGCCGC


RIBOSOME 6

CCCGACCGCTTCTAGTTCCGACTGGACTAGCTATTTGCGCGATTATTCAGC

RIBOSOME 7

CCCCTATTTCCATTTATGCTGCTAAGTCTGTCCCCAGACAGGTTCTTTGAGTAGAGC

CGATTTCTA


RIBOSOME 8

CCCTTTAGTTTCCGTTCCGCGTTTCGCTTCCCAATGTTCCGTTTCAAACCAGTT


RIBOSOME 9

CCCCCAAAATTATTCTTTGACCCATAGGACCGTTCCGTTCTGTTCCGC


RIBOSOME 10

CCCAGGTTCCCAGACAGGCGTTTATTCAGCCGC


RIBOSOME 11

CCCTTCAAACCAAAACGTCGATTCCGTGGGTTTAGC



Scavenger Hunt     Bonus Mystery     Answer Key


Secret Codes:     DNA code     m-RNA codons




Activities-To-Go Index


Activities Exchange Index


 
Custom Search on the AE Site

 

-Advertisement-